Chat with us, powered by LiveChat Question: 13. (13 Pts) You Wish To Express A Yeast Protein In E.coli. You Therefore Want To Design Primers To Amplify The Coding Region Of The Gene (shown Below On The Right) And Add Restriction Sites By PCR And Then Insert The PCR Product Into The Polylinker Region Of A Bacteria Expression Vector (the Restriction Site Map Of The Plasmid Is Shown Below On The ... | Wridemy

18 Aug Question: 13. (13 Pts) You Wish To Express A Yeast Protein In E.coli. You Therefore Want To Design Primers To Amplify The Coding Region Of The Gene (shown Below On The Right) And Add Restriction Sites By PCR And Then Insert The PCR Product Into The Polylinker Region Of A Bacteria Expression Vector (the Restriction Site Map Of The Plasmid Is Shown Below On The …

Posted at 04:39h in Science by
13. (13 pts) You wish to express a yeast protein in E.coli. You therefore want to design primers to amplify the coding region of the gene (shown below on the right) and add restriction sites by PCR and then insert the PCR product into the polylinker region of a bacteria expression vector (the restriction site map of the plasmid is shown below on the left). Hind Ncol Nhel gene of interest (coding region) Notl 5′ ATGAATTCGCGTCAATA 一, TTGCGATTACGATTAA 3. 3 TACTTAAAGCGCAGTTATAAACGCTAATGCTAATT 5 bacteria expression vector HindIII= A/AGCTT Ncol = C/CATGG SacCCGC/GG Nhel G/CTAGC E. coli ori Ncol i. Which restriction enzymes can be used to cut the vector and the PCR product for cloning the PCR product into the vector? Note that there is NO other restriction site in the coding region besides Notl as labeled. (There might be multiple possible solutions, Youjust need to write ONE of them of them)

Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.

Do you need an answer to this or any other questions?

About Wridemy

We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.

How It Works

To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Are there Discounts?

All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.

Hire a tutor today CLICK HERE to make your first order

Related Tags

Academic APA Writing College Course Discussion Management English Finance General Graduate History Information Justify Literature MLA