04 Jun Restriction Enzymes Name ___________________________________
Restriction Enzymes Name ___________________________________ Bio 210 section _____________Total points __________ What are restriction enzymes? What do you mean by palindromes? Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if they are sticky ends or blunt, 5’ overhangs or 3 ‘overhangs and the number of DNA fragments produced and the number of base pairs in each (count the top row).Remember: Analyze in the 5’à 3’ direction HindII — 5′ GTC ↓GAC 3′ 5′ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3′3′ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5′ Number of pieces of DNA _______ EcoRI — 5′ G ↓AATTC 3′ 5′ ACG ACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3′3′ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5′ Number of pieces of DNA _______ HaeIII — 5′ CC ↓ GG 3′ 5′ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3′3′ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5′ Number of pieces of DNA _______ BamI — 5′ CCTAG ↓G 3′ 5′ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3′3′ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5′ Number of pieces of DNA _______ HindII — 5′ GTC ↓- GAC 3′ and HaeIII — 5′ CC ↓ GG 3′ 5′ ACGGTCGACACGTATTATTAGTCGACTCCGCCGCCGCCGGTCATCA 3′3′ TGCCAGCTGTGCATAATAATCAGCTGAGGCGGCGGCGGCCAGTAGT 5′ Number of pieces of DNA _______ HindII — 5′ GTC ↓ GAC 3′, HaeIII — 5′ CC ↓ GG 3′ and BamI — 5′ CCTAG ↓ G 3′ 5′ ACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCG CCCCTAGGGTCATCA 3′3′ TGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5′ Number of pieces of DNA _______ What is electrophoresis? What material did you use to make the gel?________________ In gel electrophoresis DNA molecules are separated based on __________________ DNA is ________________ charged due the _______________ backbone and hence will move towards _______________ electrode. What is the buffer used to run the gel? What is the dye used to stain the gel? What is a molecular marker? What is its purpose? Given below is a Plasmid. Cut the plasmid with the given enzymes and show the pieces on the given agarose gel. Draw the DNA bands in the gel given below for the following digestionsLane 1-uncut DNA Lane 5 Molecular MarkerLane 2 cut by Pst1 Lane 6 cut by Hind IIILane 3 cut by EcoR1 Lane 7 cut by Hind III and EcoR1Lane 4 cut by BamH1 Lane 8 cut by all 4 enzymes
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Wridemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.